Description
For this assignment, the solution should be in the Code Runner. You must include
comments in your code that explain what your code is doing.
Measuring DNA Similarity
Objectives:
1. Apply the concept of program decomposition.
2. Manipulate strings.
3. Design functions in program construction that use pointers.
DNA is the hereditary material in human and other species. Almost every cell in a
person’s body has the same DNA. All information in a DNA is stored as a code in four
chemical bases: adenine (A), guanine (G), cytosine (C) and thymine(T). Different
order of these bases means different information.
One of the challenges in computational biology is determining what the codons in a
DNA sequence represent. A codon is a sequence of three nucleotides that form a unit
of genetic code in a DNA or RNA molecule. For example, given the sequence GGGA,
the codon could be a GGG or a GGA, depending on where the gene begins and the
active bases in the gene. Clues about how to interpret a DNA sequence can be found
by comparing an unknown DNA sequence to a known sequence and measuring their
similarity. If sequences are similar, then it can be hypothesized that they have
similar functions and proteins.
Assignment Details:
In this assignment, you will develop a few functions for DNA analysis. These
functions will calculate common measures of DNA similarity, such as the Hamming
distance and the Best Match between two DNA sequences. Each of the DNA
sequences you need for this assignment can be copied from this write-up and stored
in a variable in your program. There is a sample DNA sequence for a mouse, human,
and an unknown species. Your mission is to determine the identity of the unknown
by comparing it to the human and the mouse. If the unknown species is more similar
to the human than it is to the mouse, then you can conclude that the unknown
sequence is from a human. Otherwise, you can conclude that the unknown is from a
mouse.
CSCI 1310 – Assignment 4 Due Friday, Feb 24, by 8:00 am
Your assignment needs to include at least the following functions for full credit:
void calculateSimilarity(double *similarity, string DNA1, string DNA2);
string calculateBestMatch(double *bestscore, int *index, string DNA1,
string DNA2);
What to submit?
The assignment is set up in moodle. There are three code-runner questions. The first
question is for the full code (directives, prototypes, definitions and main) to test for
correctness. The other two questions will help for getting partial credit and they are
for the functions calculateSimilarity and calculateBestMatch.
It is your responsibility to copy them from the full code into these individual
questions. If you need any helper functions, then include them in the space provided
but above the function that will make the call. If you are not sure, please ask the
instructors before the deadline. Don’t forget that after the deadline, you have the
right to request an interview with your TA to review your work.
Hamming distance and similarity between two strings
Hamming distance is one of the most common ways to measure the similarity
between two strings of the same length. Hamming distance is a position-by-position
comparison that counts the number of positions in which the corresponding
characters in the string are different. Two strings with a small Hamming distance
are more similar than two strings with a larger Hamming distance.
Example:
first string = “ACCT”
second string = “ACCG”
A C C T
| | | *
A C C G
In this example, there are three matching characters and one mismatch, so the
Hamming distance is one.
The similarity score for two sequences is then calculated as follows:
similarity_score = (string length-hamming distance) / string length
similarity_score = (4-1)/4=3/4=0.75
Two sequences with a high similarity score are more similar than two sequences
with a lower similarity score.
The Best Match algorithm extends the Hamming distance calculation by finding the
CSCI 1310 – Assignment 4 Due Friday, Feb 24, by 8:00 am
best overlap of the two strings. For any two strings, calculate the Hamming distance
between the string and substring starting at each position of the string.
calculateSimilarity(double*, string, string)
The calculateSimilarity() function should take two arguments that are both strings
and a double pointer that stores the similarity between the strings. You can declare
a double pointer just as you would an integer pointer:
double x;
double *dPtr = &x;
The function should calculate the similarity score for the two strings and update the
similarity with that score.
Note: when you test calculateSimilarity(), pass in strings where you can calculate the
similarity by hand before passing it real data. That will help you identify errors in
your algorithm.
calculateBestMatch(double*, int*, string, string)
The calculateBestMatch() function should take four arguments – one integer
pointers and double pointer and two strings. The double pointers store the
Similarity Score calculation and the integer pointer store the index in the string
where the best match starts. The two string arguments are the two strings to
compare. The second string argument is the substring to search for. The first string
is the string you are searching. This functions returns a string which is DNA
sequence from the mouse/human DNA which best matches with the user entered
sequence with a high similarity score.
Note: you will need to be aware of the end of each string to make sure that you don’t
loop off the end of either string.
Functionality in main()
In your main() function, you will need to call the other functions you have written.
You need to use the mouse and human DNA samples shown below in this write-up
and unknown DNA sample just for testing your program. Your first task is to ask the
user to enter the unknown DNA sequence and store it in a variable. You should
output the result of the function calls in the main() function. After calling
calculateSimularity(), you need to output the identity of the unknown DNA
sequence.
if the unknownDNA is more similar to the humanDNA
print “Human”
else if the unknownDNA is more similar to the mouseDNA
print “Mouse”
CSCI 1310 – Assignment 4 Due Friday, Feb 24, by 8:00 am
else unknownDNA is equally similar to both mouse and human
print “Identity cannot be determined.”
Before calling calculateBestMatch(), you need to prompt the user for a search string.
You need to compare the search string to the mouse DNA and Human DNA, you
would do something like the following:
cout<<”Enter a substring:;
getline(cin, subStr);
calculateBestMatch(&similarityscore, &index, mouseDNA,
subStr);
calculateBestMatch(&similarityscore, &index, humanDNA,
subStr);
After calling calculateBestMatch(), you need to display the DNA sequence that is the
best match as well as the best similarity score. If there isn’t a match of any character,
print “Match not found.”
Here is the skeleton/high level code which you need to follow:
#include
#include
using namespace std;
//Declare the humanDNA as const string & initialize with the value mentioned in writeup
//Declare the mouseDNA as const string & initialize with the value mentioned in writeup
//Declare the Function Headers
int main()
{
//Declare all the necessary variables needed for your program
cout<<“Enter an unknownDNA:”<<endl; //ask the user to enter the unknowDNA cin>> unknownDNA;
//Call the calculateSimilarity function to compare unknownDNA with humanDNA
//Call the calculateSimilarity function to compare unknownDNA with mouseDNA
//If the unknownDNA is more similar to the humanDNA
cout << “Human” <<endl;
//Else If the unknownDNA is more similar to the mouseDNA
cout << “Mouse” <<endl;
CSCI 1310 – Assignment 4 Due Friday, Feb 24, by 8:00 am
//Else unknownDNA is equally similar to both mouse and human
cout<< “Identity cannot be determined”<<endl;
cout<<“Enter a substring:”<<endl; //Ask the user to enter a sequence cin>> subStr;
//Pass the user entered sequence with humanDNA and mouseDNA to the
//calculateBestMatch function
calculateBestMatch(&similarityscore, &index, humanDNA,
subStr);
//If a best match is found print in the below format
cout<< “The Best Match found in humanDNA is “<<
bestsequence << ” with a similarity score of ” <<
similarityscore <<endl;
//else print
cout<<”Match not found”<<endl;
calculateBestMatch(&similarityscore, &index, mouseDNA,
subStr);
//If a best match is found print in the below format
cout<< “The Best Match found in mouseDNA is “<<
bestsequence << ” with a similarity score of ” <<
similarityscore <<endl;
//else print
cout<<”Match not found”<<endl;
return 0;
}
Other helpful hints
Write the code without pointers first. Once you are confident that your algorithms
are correct, modify your functions to use pointers.
DNA samples
Use the following human, mouse, and unknown DNA strings in your program.
humanDNA =
“CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCAG
CACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGAC
CTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTC
CACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCT
GACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAGTTTTC
CTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG”
CSCI 1310 – Assignment 4 Due Friday, Feb 24, by 8:00 am
mouseDNA =
“CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT
TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC
CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA
TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT
GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC
TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG”
unknownDNA =
“CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT
CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC
CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATC
TACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT
GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTTC
TTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG”
Additional practice problems:
If you are interested in additional problems for practice, here are a few more
problems you can work on. We won’t be grading them, but a little extra practice
never hurt anyone.
Complement sequence function
DNA is double stranded even though we always write a single strand’s nucleotide
sequence. This is because we can infer the other stands sequence from the given
strand. Every A on one strand has a complementary T on the opposite strand (every
C has a G). Therefore we can create the complement strand by swapping the
nucleotides with the complementary nucleotide. Create a function to take the
sequence and produce the complement sequence.
Reverse complement sequence function
You now have the complement strand, but the DNA is read in the forward direction
for the given strand and in the reverse direction for the complementary strand.
Therefore, we must reverse the strand (first character becomes the last character,
second becomes second to last, and so on.) to print it correctly. Create a function to
reverse the complement of a given DNA sequence. Now we can search both strands of
the given DNA sequences by using our previously created functions.
